tab separation of the file

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT

ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC

ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

2

With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41

It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05

add a comment |

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT

ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC

ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

2

With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41

It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05

add a comment |

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT

ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC

ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

I have a file with seq likes this

ATCGTTTCTCAGCCTTTTGGCAAGACCAAGTGTAGTATCTGTTCTTATCAGATATTGGTATCTGCAGGCACTCCTGGAACCAAT

ATCACTTCTCAACCTTTTGACTAAGATCAAGTGTAATATCTATCTTTATCAGTTTAATATCTGAGATCTCCTTTATCTGAGGACAATATATTTAATGGATTTTTGGAACAGAGAGAAGGAATAGGAGCTTGTCCTGTCCACTCCATGCATTGACCTGGTATTGCAGGACCTCCAGAAACACCACCCCCTCC

ACGCATTATCCGCCTATTGGCTAAAAACAAATGTAGTATCTGTTCCTATCAGTTAAAGCATCAAATGTGGTCTCTAAGTTCAGGGAATTAAATTAATATTTGGAATTGGGAGATGGTTTGGGAGCTTGCTCTATCCTCTCCATGCCTCAGCATGTAATTGCAATGCTTTCAGGAGTGGTGCATTCCTT

It has 3 lines.
I want for each line each letter gets separated by tab and then want to store it in another file. How can i do it.

text-processing sed awk

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

edited 1 hour ago

Rui F Ribeiro

41.3k1481140

asked Dec 17 '14 at 22:38

user3138373

89041630

asked Dec 17 '14 at 22:38

user3138373

89041630

asked Dec 17 '14 at 22:38

user3138373

89041630

2

With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41

It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05

add a comment |

2

With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41

It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05

With such questions you should always give an example for the expected output.

– Hauke Laging
Dec 17 '14 at 22:41

It's a DNA sequence... How long is the strand? ie you should split tabs at the end of the chain. Add more info as Hauke states.

– eyoung100
Dec 17 '14 at 23:05

add a comment |

4 Answers
4

active

oldest

votes

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

add a comment |

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

add a comment |

In awk:

awk -F '' -vOFS='t' '{$1=$1}1' file > new_file

Borrowed the idiom {$1=$1}1 from an answer to one of your other questions.

This sets the field separator to nothing (-F ''), which means that each record is read character-by-character. The output field separator is set to a TAB character (-vOFS='t') and the idiom {$1=$1}1 is (as far as I can tell) a no-op that has the side effect of causing awk to insert the OFS between every two fields before printing them all.

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

1

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

1

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

add a comment |

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn'  'nt' >outfile

I preprocess fold's input w/ tr by replacing the instream newline characters w/ returns. fold is printing a newline character for every column in input - each of your capital letters - but it resets its counter on returns and so when tr does the final post-processing and converts fold's newlines to tabs there are no extra tab characters in output. The output is three lines with a tab character following each character but the last on each line.

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

add a comment |

Your Answer

StackExchange.ready(function() {
var channelOptions = {
tags: "".split(" "),
id: "106"
};
initTagRenderer("".split(" "), "".split(" "), channelOptions);

StackExchange.using("externalEditor", function() {
// Have to fire editor after snippets, if snippets enabled
if (StackExchange.settings.snippets.snippetsEnabled) {
StackExchange.using("snippets", function() {
createEditor();
});
}
else {
createEditor();
}
});

function createEditor() {
StackExchange.prepareEditor({
heartbeatType: 'answer',
autoActivateHeartbeat: false,
convertImagesToLinks: false,
noModals: true,
showLowRepImageUploadWarning: true,
reputationToPostImages: null,
bindNavPrevention: true,
postfix: "",
imageUploader: {
brandingHtml: "Powered by u003ca class="icon-imgur-white" href="https://imgur.com/"u003eu003c/au003e",
contentPolicyHtml: "User contributions licensed under u003ca href="https://creativecommons.org/licenses/by-sa/3.0/"u003ecc by-sa 3.0 with attribution requiredu003c/au003e u003ca href="https://stackoverflow.com/legal/content-policy"u003e(content policy)u003c/au003e",
allowUrls: true
},
onDemand: true,
discardSelector: ".discard-answer"
,immediatelyShowMarkdownHelp:true
});

}
});

draft saved

draft discarded

Sign up or log in

StackExchange.ready(function () {
StackExchange.helpers.onClickDraftSave('#login-link');
});

Post as a guest

Name

Required, but never shown

StackExchange.ready(
function () {
StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2funix.stackexchange.com%2fquestions%2f174755%2ftab-separation-of-the-file%23new-answer', 'question_page');
}
);

Post as a guest

Name

Required, but never shown

4 Answers
4

active

oldest

votes

4 Answers
4

active

oldest

votes

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

add a comment |

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

add a comment |

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

If I have understood your intention correctly then this does it:

sed -e 's/./&t/g' -e $'s/t$//' file

The second replacement deletes the tab at the end of the line.

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

edited Dec 18 '14 at 0:40

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

answered Dec 17 '14 at 22:41

Hauke Laging

57.2k1287135

add a comment |

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

add a comment |

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

add a comment |

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

Try doing this using perl:

perl -ne 'print join "t", split //' file > new_file

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

edited Dec 17 '14 at 22:48

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

answered Dec 17 '14 at 22:41

Gilles Quenot

16.3k14053

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

add a comment |

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

If you like golf: perl -ne '$,="t";print split//' file > new_file

– Joseph R.
Dec 18 '14 at 5:00

add a comment |

In awk:

awk -F '' -vOFS='t' '{$1=$1}1' file > new_file

Borrowed the idiom {$1=$1}1 from an answer to one of your other questions.

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

1

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

1

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

add a comment |

In awk:

awk -F '' -vOFS='t' '{$1=$1}1' file > new_file

Borrowed the idiom {$1=$1}1 from an answer to one of your other questions.

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

1

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

1

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

add a comment |

In awk:

awk -F '' -vOFS='t' '{$1=$1}1' file > new_file

Borrowed the idiom {$1=$1}1 from an answer to one of your other questions.

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

In awk:

awk -F '' -vOFS='t' '{$1=$1}1' file > new_file

Borrowed the idiom {$1=$1}1 from an answer to one of your other questions.

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

edited Apr 13 '17 at 12:36

Community♦

edited Apr 13 '17 at 12:36

Community♦

edited Apr 13 '17 at 12:36

Community♦

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

answered Dec 18 '14 at 4:49

Joseph R.

28.6k375116

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

1

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

1

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

add a comment |

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

1

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

1

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

pretty good. not everybody breaks it down by arguments. someday I'll learn how to use awk probably - and I'll need it broken down that way I expect. thanks.

– mikeserv
Dec 18 '14 at 4:52

@mikeserv Thanks. I have promised myself to learn proper awk one day, too :)

– Joseph R.
Dec 18 '14 at 4:53

I wonder if that {$1=$1}1 thing is anything like sed's s/.{0,1}/ /g? You know - matching the null field between the strings? That's pretty cool, anyway.

– mikeserv
Dec 18 '14 at 4:56

@mikeserv Probably not. As far as I can tell, $1=$1 doesn't do anything but tricks awk into thinking the first field has been re-assigned so that it knows to insert the OFS between adjacent fields. The 1 at the end is to simply return a "true" value and cause awk to print the current record by default.

– Joseph R.
Dec 18 '14 at 4:58

add a comment |

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn'  'nt' >outfile

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

add a comment |

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn'  'nt' >outfile

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

add a comment |

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn'  'nt' >outfile

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

I think you should give fold a go:

tr \n \r <infile | fold -w1 | tr 'rn'  'nt' >outfile

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

answered Dec 18 '14 at 3:41

mikeserv

45.8k668160

add a comment |

draft saved

draft discarded

Thanks for contributing an answer to Unix & Linux Stack Exchange!

Please be sure to answer the question. Provide details and share your research!

But avoid …

Asking for help, clarification, or responding to other answers.

Making statements based on opinion; back them up with references or personal experience.

To learn more, see our tips on writing great answers.

draft saved

draft discarded

Sign up or log in

StackExchange.ready(function () {
StackExchange.helpers.onClickDraftSave('#login-link');
});

Post as a guest

Name

Required, but never shown

Post as a guest

Name

Required, but never shown

Sign up or log in

StackExchange.ready(function () {
StackExchange.helpers.onClickDraftSave('#login-link');
});

Post as a guest

Name

Required, but never shown

Sign up or log in

StackExchange.ready(function () {
StackExchange.helpers.onClickDraftSave('#login-link');
});

Post as a guest

Name

Required, but never shown

Sign up or log in

StackExchange.ready(function () {
StackExchange.helpers.onClickDraftSave('#login-link');
});

Post as a guest

Name

Required, but never shown

Name

Required, but never shown

Name

Required, but never shown

This page is only for reference, If you need detailed information, please check here

搜尋此網誌

Sstrhsrtj